Prev. | 

RIKEN DNA Bank Human Resource - HDGFL2

Gene ID NCBI Gene 84717 |  KEGG hsa:84717
Gene Symbol HDGFL2
Protein Name HDGF like 2
Synonyms HDGF-2|HDGF2|HDGFRP2|HRP-2|HRP2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083100 IRAL007M12 pOTB7 BC000755 NM_032631 Full
HGY089380 IRAL023H12 pOTB7 BC009449 NM_032631 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025846 W01A064K06 pENTR-TOPO IRAL007M12 BC000755 NM_032631  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075657 ARe89C09 pKA1U5 NM_032631.2  
GGCCGCCGCCGCCGCCGCAGCCGCTACCGCCGCTGCAGCCGCTTTCCGCGGCCTGGGCCT
HKR390080 RBd75D08 pGCAP10 NM_032631.2  
GGCCGCCGCAGCCGCTACCGCCGCTGCAGCCGCTTTCCGCGGCCTGGGCCTCTCGCCGTC
HKR396801 RBd92A01 pGCAP10 NM_032631.2  
GGTCCCGCTCCCGCCCCCGGCTTCGCCTCCCGCTGCCGCCGCCGCCGCCGCCGCAGCCGC
HKR402888 RBdS007D16 pGCAP10 NM_032631.2  
TGTCGCCTCCCGCTGCCGCCGCCGCCGCCGCCGCAGCCGCTACCGCCGCTGCAGCCGCTT
HKR475057 RBdS187K17 pGCAP10 NM_032631.2  
GGTCCCGCTCCCGCCCCCGGCTTCGCCTCCCGCTGCCGCCGCCGCCGCCGCCGCAGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl