Prev. |  KEGG KO K00814 > 

RIKEN DNA Bank Human Resource - GPT2

Gene ID NCBI Gene 84706 |  KEGG hsa:84706
Gene Symbol GPT2
Protein Name glutamic--pyruvic transaminase 2
Synonyms ALT2|GPT 2|MRT49
Ortholog resource in our bank

  GPT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY098833 IRAL047B09 pOTB7 BC051364 NM_133443 Partial
HGY100330 IRAL050N18 pOTB7 BC062555 NM_133443 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095627 M01C039B03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095675 M01C039D03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095723 M01C039F03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095771 M01C039H03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095819 M01C039J03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095867 M01C039L03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095915 M01C039N03 pDONR221 MGC09-C02 BC062555 NM_133443  
HGE095963 M01C039P03 pDONR221 MGC09-C02 BC062555 NM_133443  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078879 ARe97D07 pKA1U5 NM_133443.2  
GGGGCGCCGGGCGCGGGGATGCGGCTGTGGGCGCCGGGGCCGGGTAGCTGCTCCAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl