Prev. | 

RIKEN DNA Bank Human Resource - HINT2

Gene ID NCBI Gene 84681 |  KEGG hsa:84681
Gene Symbol HINT2
Protein Name histidine triad nucleotide binding protein 2
Synonyms HIT-17
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039405 IRAK098I13 pCMV-SPORT6 BC047737 NM_032593 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044878 ARe12D06 pKA1U5 NM_032593.2  
GACCCACGGCCGGCCGCGGAGCCGAGTGCTGACCCGGGTGAGAGGTTCCCGCGGCTCAGG
HKR078026 ARe95B02 pKA1U5 NM_032593.2  
GACCCCGCTTCCCCGCGCCCGGAGTCCCCACCCACGGCCGGCCGCGGAGCCGAGTGCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl