Prev. | 

RIKEN DNA Bank Human Resource - GLYR1

Gene ID NCBI Gene 84656 |  KEGG hsa:84656
Gene Symbol GLYR1
Protein Name glyoxylate reductase 1 homolog
Synonyms BM045|HIBDL|N-PAC|NP60|hNDF
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001965 IRAK004P05 pCMV-SPORT6 BC003693 NM_032569 Partial/var
HGY019039 IRAK047J23 pBluescriptR BC032855 NM_032569 Full/var
HGX047820 IRAK119J04 pCMV-SPORT6 BC063039 NM_032569 Partial/var
HGX056004 IRAK140A04 pCMV-SPORT6 BC064940 NM_032569 Full/var
HGY096894 IRAL042D22 pOTB7 BC022809 NM_032569 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023614 W01A059A14 pENTR-TOPO IRAK047J23 BC032855 NM_032569  
HGE023616 W01A059A16 pENTR-TOPO IRAK047J23 BC032855 NM_032569  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166505 ARi16E09 pGCAP10 NM_032569.3  
CGGCCGGCCGATGGTTCCCGGCGGCCCGTGCGTCGGCGGTGGTTGGGTGGTAAGATGGCG
HKR405909 RBdS014M21 pGCAP10 NM_032569.3  
GGTTGGGTGGTAAGATGGCGGCTGTGAGTCTGCGGCTCGGCGACTTGGTGTGGGGGAAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl