Prev. | 

RIKEN DNA Bank Human Resource - AFAP1L2

Gene ID NCBI Gene 84632 |  KEGG hsa:84632
Gene Symbol AFAP1L2
Protein Name actin filament associated protein 1 like 2
Synonyms CTB-1144G6.4|KIAA1914|XB130
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005927 IRAK014N15 pCMV-SPORT6 BC024314 NM_032550 Full
HGX031702 IRAK079E06 pCMV-SPORT6 BC035713 NM_032550 Partial/var
HGY097408 IRAL043I16 pOTB7 BC033212 NM_032550 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092023 M01C030A23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092071 M01C030C23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092119 M01C030E23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092167 M01C030G23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092215 M01C030I23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092263 M01C030K23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092311 M01C030M23 pDONR221 MGC04-E12 BC024314 ENST00000369271  
HGE092359 M01C030O23 pDONR221 MGC04-E12 BC024314 ENST00000369271  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043236 ARe08B12 pKA1U5 NM_032550.2  
GGCTGAGCCGAGCGCCGGGAGAGCAGCGCAGAAGCCGAGCCGCGAGGAGCGCACTCCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl