Prev. |  KEGG KO K10087 > 

RIKEN DNA Bank Human Resource - GNPTG

Gene ID NCBI Gene 84572 |  KEGG hsa:84572
Gene Symbol GNPTG
Protein Name N-acetylglucosamine-1-phosphate transferase subunit gamma
Synonyms C16orf27|GNPTAG|LP2537|RJD9
Featured content Lysosome (human)
Featured content Lectin - human
Ortholog resource in our bank

  GNPTG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013387 IRAK033H19 pBluescriptR BC014592 NM_032520 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061626 ARe54B02 pKA1U5 NM_032520.3  
GGGCCGCTGCGGCGCGATGGCGGCGGGGCTGGCGCGGCTCCTGTTGCTCCTCGGGCTCTC
HKR276693 ARiS191M05 pGCAP10 NM_032520.3  
GACTTCACGTGACCGCGCGGCGGCCGCTGCGGCGCGATGGCGGCGGGGCTGGCGCGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl