DNA Bank Top |  KEGG KO K10435 > 

RIKEN DNA Bank Human Resource - MAP1LC3A

Gene ID NCBI Gene 84557 |  KEGG hsa:84557
Gene Symbol MAP1LC3A
Protein Name microtubule associated protein 1 light chain 3 alpha
Synonyms ATG8E|LC3|LC3A|MAP1ALC3|MAP1BLC3
Featured content Autophagy (human)
Featured content Mitophagy - human
Featured content Ferroptosis - human

Link

Ortholog resource in our bank

  MAP1LC3A


External database

human MAP1LC3A

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19195 pcDNA3.1 3xFLAG::LC3A Expression vectors of human ATG8 homolog LC3A tagged with 3xFLAG at N-terminus.    
RDB05021 pAxCALNLhMAP1LC3A(reverse) Shuttle vector to generate rAd expressing human MAP1LC3A    
RDB05020 pAxCALNLhMAP1LC3A(forward) Shuttle vector to generate rAd expressing human MAP1LC3A    
RDB04125 pAxCALNLhMAP1LC3A (reverse) Shuttle vector to generate rAd harboring human MAP1LC3A    
RDB03551 pAxCALNLhMAP1LC3A (forward) Shuttle vector to generate rAd harboring human MAP1LC3A (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006111 IRAK015E15 pCMV-SPORT6 BC015810 NM_032514 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187724 ARi69F04 pGCAP10 NM_032514.2  
GGCAGCCGCAGCCGCCGTGCTCAGCGCGAGCCCCGGAGCCCTTGAGCGCGAGGCGCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl