Prev. |  KEGG KO K14831 > 

RIKEN DNA Bank Human Resource - MAK16

Gene ID NCBI Gene 84549 |  KEGG hsa:84549
Gene Symbol MAK16
Protein Name MAK16 homolog
Synonyms MAK16L|RBM13
Ortholog resource in our bank

  MAK16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025076 IRAK062L12 pCMV-SPORT6 BC028230 NM_032509 Full/var
HGX033172 IRAK082P12 pCMV-SPORT6 BC039740 NM_032509 Full/var
HGX043170 IRAK107P10 pCMV-SPORT6 BC050528 NM_032509

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326903 RBb17E07 pKA1U5 NM_032509.2  
GATCCGACCGGAAGTTGCACGCTGAGCCGCGGACACCATGCAGTCGGATGATGTTATCTG
HKR348924 RBb72F04 pGCAP1 NM_032509.2  
GTGCTGTGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl