Prev. | 

RIKEN DNA Bank Human Resource - SRRM4

Gene ID NCBI Gene 84530 |  KEGG hsa:84530
Gene Symbol SRRM4
Protein Name serine/arginine repetitive matrix 4
Synonyms KIAA1853|MU-MB-2.76|nSR100
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR430210 RBdS075I18 pGCAP10 NM_194286.2  
GGCGCACGCACACACATCCGACCCTGTCGCCTCTTCTCTCCTGGTGCTGCCCAGAAAGCC
HKR474841 RBdS187B17 pGCAP10 NM_194286.2  
GGCGCACGCACACACATCCGACCCTGTCGCCTCTTCTCTCCTGGTGCTGCCCAGAAAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl