Prev. |  KEGG KO K10427 > 

RIKEN DNA Bank Human Resource - DCTN5

Gene ID NCBI Gene 84516 |  KEGG hsa:84516
Gene Symbol DCTN5
Protein Name dynactin subunit 5
Synonyms -
Ortholog resource in our bank

  DCTN5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083033 IRAL007J17 pOTB7 BC004191 NM_032486

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097601 M01C044A01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097649 M01C044C01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097697 M01C044E01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097745 M01C044G01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097793 M01C044I01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097841 M01C044K01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097889 M01C044M01 pDONR221 MGC11-E01 BC004191 NM_032486  
HGE097937 M01C044O01 pDONR221 MGC11-E01 BC004191 NM_032486  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163228 ARi08B04 pGCAP10 NM_032486.2  
AAGTAGCCGGAATCTCTGAAAGACTGACCGACTGACTCTGACAGGATCCGGGGCTGAGGG
HKR405921 RBdS014N09 pGCAP10 NM_032486.2  
GAGTAGCCGGAATCTCTGAAAGACTGACCGACTGACTCTGACAGGATCCGGGGCTGAGGG
HKR406310 RBdS015M22 pGCAP10 NM_032486.2  
GAGGATCCGGGGCTGAGGGAAGGAGGCGGCGGCCATGGAGTTGGGCGAGCTGCTCTACAA
HKR452962 RBdS132G18 pGCAP10 NM_032486.2  
TTGAGCGGCCGGAAGTAGCCGGAATCTCTGAAAGACTGACCGACTGACTCTGACAGGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl