Prev. |  KEGG KO K18693 > 

RIKEN DNA Bank Human Resource - PLPP5

Gene ID NCBI Gene 84513 |  KEGG hsa:84513
Gene Symbol PLPP5
Protein Name phospholipid phosphatase 5
Synonyms DPPL1|HTPAP|PPAPDC1B
Ortholog resources KEGG ortholog (KEGG orthology K18693) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019072 IRAK047L08 pBluescriptR BC033025 NM_032483 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105618 M01C064A18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105666 M01C064C18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105714 M01C064E18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105762 M01C064G18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105810 M01C064I18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105858 M01C064K18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105906 M01C064M18 pDONR221 06_06-F09 BC033025 ENST00000317577  
HGE105954 M01C064O18 pDONR221 06_06-F09 BC033025 ENST00000317577  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184923 ARi62F03 pGCAP10 NM_032483.3  
GGCGGCCGGATGGGGAAGGCGGCGGCGGCGGTGGCCTTTGGGGCCGAAGTGGGCGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl