Prev. | 

RIKEN DNA Bank Human Resource - FAM120B

Gene ID NCBI Gene 84498 |  KEGG hsa:84498
Gene Symbol FAM120B
Protein Name family with sequence similarity 120B
Synonyms CCPG|KIAA1838|PGCC1|SAN1|dJ894D12.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091938 IRAL029O02 pOTB7 BC012177 NM_032448

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100411 M01C051A11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100459 M01C051C11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100507 M01C051E11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100555 M01C051G11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100603 M01C051I11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100651 M01C051K11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100699 M01C051M11 pDONR221 MGC15-A06 BC012177 ENST00000366751  
HGE100747 M01C051O11 pDONR221 MGC15-A06 BC012177 ENST00000366751  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442112 RBdS105E16 pGCAP10 NM_032448.1  
GTGGGCCTAGGGTGCAGCGGGCGCGTCTGCGGCTGGTGTTGGCGCATCTCTAGATCCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl