Prev. | 

RIKEN DNA Bank Human Resource - HHIPL1

Gene ID NCBI Gene 84439 |  KEGG hsa:84439
Gene Symbol HHIPL1
Protein Name HHIP like 1
Synonyms KIAA1822|UNQ9245
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070010 ARe75A10 pKA1U5 NM_001127258.3 partial cds  
GGGCTGCTGCGATGAGGGGCGCGACGCCGAGCTGANCCGCCGCTTCTGGGCCCTGGCGAG
HKR165730 ARi14F10 pGCAP10 NM_001127258.3 full cds  
GAGGGAAGGGGAGCGCCCGCCCCTTCCCTGCCGCCGCGAGCGCCCCGGGAGGGGACCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl