DNA Bank Top |  KEGG KO K14838 > 

RIKEN DNA Bank Human Resource - NIFK

Gene ID NCBI Gene 84365 |  KEGG hsa:84365
Gene Symbol NIFK
Protein Name nucleolar protein interacting with the FHA domain of MKI67
Synonyms MKI67IP|Nopp34

Link

Ortholog resource in our bank

  NIFK

External database

human NIFK

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB17337 pEF6-FLAG-human MKI67IP Expression vector of human MKI67IP tagged with FLAG at N-terminus.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018443 IRAK046B19 pBluescriptR BC024238 NM_032390 Full/var
HGX008782 IRAK021P22 pCMV-SPORT6 BC012457 NM_032390 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000984 W01A002H16 pENTR-TOPO IRAK046B19 BC024238 NM_032390  
HGE044559 W01A111G15 pENTR-TOPO IRAK046B19 BC024238 NM_032390  
HGE044561 W01A111G17 pENTR-TOPO IRAK046B19 BC024238 NM_032390  
HGE044563 W01A111G19 pENTR-TOPO IRAK046B19 BC024238 NM_032390  
HGE044565 W01A111G21 pENTR-TOPO IRAK046B19 BC024238 NM_032390  
HGE044567 W01A111G23 pENTR-TOPO IRAK046B19 BC024238 NM_032390  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208156 ARiS020G12 pGCAP10 NM_032390.4  
GACTTCCGCCTCGGGGGAGCTGGGAGCCCGACGTTTCCGGGAGCGCCGCGTGGTTAGCGT
HKR264716 ARiS161N04 pGCAP10 NM_032390.4  
GCCGACGTTTCCGGGAGCGCCGCGTGGTTAGCGTCGGCGGCTTTTGGCATGGCGACTTTT
HKR322802 RBb07A02 pKA1U5 NM_032390.4  
GGGTTAGCGTCGGCGGCTTTTGGCATGGCGACTTTTTCTGGCCCGGCTGGGCCAATCCTG
HKR326951 RBb17G07 pKA1U5 NM_032390.4  
GGTGGTTAGCGTCGGCGGCTTTTGGCATGGCGACTTTTTCTGGCCCGGCTGGGCCAATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl