Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARFGAP2

Gene ID (NCBI) 84364
Gene Symbol ARFGAP2
Protein Name ADP-ribosylation factor GTPase activating protein 2
Synonyms IRZ|NBLA10535|ZFP289|ZNF289
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12493)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX031271 IRAK078C23 pCMV-SPORT6 BC036823 NM_032389 Full/var
HGY093231 IRAL033B07 pOTB7 BC030148 NM_032389

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR344905 RBb62E09 pGCAP1 NM_032389.3  
GGGAGAGAAAATGGCGGCGGAGCCGAACAAGACCGAAATCCAGACTCTTTTTAAGAGGCT
HKR462676 RBdS156L12 pGCAP10 NM_032389.3  
TGANANNNAATGGCGGCGGAGCCGAACAAGACCGAAATCCAGACTCTTTTTAAGAGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl