Prev. |  KEGG KO K12493 > 

RIKEN DNA Bank Human Resource - ARFGAP2

Gene ID NCBI Gene 84364 |  KEGG hsa:84364
Gene Symbol ARFGAP2
Protein Name ADP ribosylation factor GTPase activating protein 2
Synonyms IRZ|NBLA10535|ZFP289|ZNF289
Featured content Endocytosis (human)
Ortholog resource in our bank

  ARFGAP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB20105 pcDNA3-hARFGAP2-HA Expression vector of human ARFGAP2 for mammalian cells, C-teminal HA-tag.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031271 IRAK078C23 pCMV-SPORT6 BC036823 NM_032389 Full/var
HGY093231 IRAL033B07 pOTB7 BC030148 NM_032389

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR344905 RBb62E09 pGCAP1 NM_032389.3  
GGGAGAGAAAATGGCGGCGGAGCCGAACAAGACCGAAATCCAGACTCTTTTTAAGAGGCT
HKR462676 RBdS156L12 pGCAP10 NM_032389.3  
TGANANNNAATGGCGGCGGAGCCGAACAAGACCGAAATCCAGACTCTTTTTAAGAGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.12.05

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl