Prev. |  KEGG KO K20295 > 

RIKEN DNA Bank Human Resource - COG8

Gene ID NCBI Gene 84342 |  KEGG hsa:84342
Gene Symbol COG8
Protein Name component of oligomeric golgi complex 8
Synonyms CDG2H|DOR1
Ortholog resource in our bank

  COG8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169273 ARi23D01 pGCAP10 NM_032382.3  
GAAGATGGCGACCGCGGCGACTATCCCATCGGTAGCCACGGCCACAGCAGCGGCTCTCGG
HKR218256 ARiS045K16 pGCAP10 NM_032382.3  
GGTTGTTGCTGGGAAGATGGCGACCGCGGCGACTATCCCATCGGTAGCCACGGCCACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl