Prev. |  KEGG KO K02355 > 

RIKEN DNA Bank Human Resource - GFM2

Gene ID NCBI Gene 84340 |  KEGG hsa:84340
Gene Symbol GFM2
Protein Name G elongation factor mitochondrial 2
Synonyms EF-G2mt|EFG2|MRRF2|MST027|MSTP027|RRF|RRF2|RRF2mt|hEFG2|mEF-G 2
Ortholog resources KEGG ortholog (KEGG orthology K02355) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006347 IRAK015O11 pCMV-SPORT6 BC015712 NM_032380 Full
HGY018494 IRAK046D22 pBluescriptR BC030612 NM_032380 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444215 RBdS110I23 pGCAP10 NM_032380.3  
GGTGGCTGCCCGAGGCGGTAGAGCGGAGAAAGCCTATTTTCTTTTCGTTTAGATACATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl