Prev. | 

RIKEN DNA Bank Human Resource - ELOF1

Gene ID NCBI Gene 84337 |  KEGG hsa:84337
Gene Symbol ELOF1
Protein Name elongation factor 1 homolog
Synonyms ELF1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084362 IRAL010P02 pOTB7 BC007516 NM_032377 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028099 W01A070E03 pENTR-TOPO flj0031d10 AK001171 NM_032377  
HGE028101 W01A070E05 pENTR-TOPO flj0031d10 AK001171 NM_032377  
HGE028107 W01A070E11 pENTR-TOPO flj0031d10 AK001171 NM_032377  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176130 ARi40F10 pGCAP10 NM_032377.3  
GACTATCTCCCGGGTGAACGGAGCTTTCGCAGCTGGAGAAGGCTCATCCACCTGCAGACA
HKR222094 ARiS055D22 pGCAP10 NM_032377.3  
GAGGAGTCGGAAGTCACTATCTCCCGGGTGAACGGAGCTTTCGCAGCTGGAGAAGGCTCA
HKR368504 RBd21E08 pGCAP10 NM_032377.3  
GAGAGGGGTTTCCGCTTCCGGCAGGAGTCGGAAGTCACTATCTCCCGGGTGAACGGAGCT
HKR371330 RBd28F10 pGCAP10 NM_032377.3  
GAGGAGTCGGAAGTCACTATCTCCCGGGTGAACGGAGCTTTCGCAGCTGGAGAAGGCTCA
HKR462589 RBdS156H21 pGCAP10 NM_032377.3  
GAGTCACTATCTCCCGGGTGAACGGAGCTTTCGCAGCTGGAGAAGGCTCATCCACCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl