Prev. | 

RIKEN DNA Bank Human Resource - MCRIP2

Gene ID NCBI Gene 84331 |  KEGG hsa:84331
Gene Symbol MCRIP2
Protein Name MAPK regulated corepressor interacting protein 2
Synonyms C16orf14|FAM195A|c349E10.1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083440 IRAL008J24 pOTB7 BC001912 NM_138418

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097622 M01C044A22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097670 M01C044C22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097718 M01C044E22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097766 M01C044G22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097814 M01C044I22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097862 M01C044K22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097910 M01C044M22 pDONR221 MGC11-F11 BC001912 ENST00000318651  
HGE097958 M01C044O22 pDONR221 MGC11-F11 BC001912 ENST00000318651  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205229 ARiS013B05 pGCAP10 NM_138418.2  
GGCCCGCAGTCCGTTAAGTGCGAGCCCCGGCGCAGGGGCCGGATCTGGCCGGGGGCCGGC
HKR336825 RBb42B01 pGCAP1 NM_138418.2  
GGTGTCCGGGGTCAGCCCGAGCCCGTGCGGGCCCTTTAAGGGCCGGGGGCGTGTAGCGGG
HKR364857 RBd12C09 pGCAP10 NM_138418.2  
GGTGTCCGGGGTCAGCCCGAGCCCGTGCGGGCCCTTTAAGGGCCGGGGGCGTGTAGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl