Prev. | 

RIKEN DNA Bank Human Resource - ZNF414

Gene ID NCBI Gene 84330 |  KEGG hsa:84330
Gene Symbol ZNF414
Protein Name zinc finger protein 414
Synonyms ZFP414
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089157 IRAL022O21 pOTB7 BC007310 NM_032370
HGY103339 IRAL058F19 pOTB7 BC071937 NM_032370 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085644 M01C014B20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085692 M01C014D20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085740 M01C014F20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085788 M01C014H20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085836 M01C014J20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085884 M01C014L20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085932 M01C014N20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  
HGE085980 M01C014P20 pDONR221 FLJ04-H10 AK074191 ENST00000255616  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420671 RBdS051L07 pGCAP10 NM_032370.2  
TGAGAGCTGAGAGGTGGAAAATGGCGCTGACGTGAGCGCGAACTCGCACTGCCCAGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl