Prev. | 

RIKEN DNA Bank Human Resource - ZBED3

Gene ID NCBI Gene 84327 |  KEGG hsa:84327
Gene Symbol ZBED3
Protein Name zinc finger BED-type containing 3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088820 IRAL022A20 pOTB7 BC007239 NM_032367 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018072 W01A045C24 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018100 W01A045E04 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018106 W01A045E10 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018108 W01A045E12 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018118 W01A045E22 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018146 W01A045G02 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018152 W01A045G08 pENTR-TOPO IRAL022A20 BC007239 NM_032367  
HGE018158 W01A045G14 pENTR-TOPO IRAL022A20 BC007239 NM_032367  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276776 ARiS191P16 pGCAP10 NM_032367.2  
GGGGACAAAATGTCAGCGAGGCGCCTGGAGGGGGATCTACCATCTCGGACTCCCGACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl