Prev. |  KEGG KO K18732 > 

RIKEN DNA Bank Human Resource - SARNP

Gene ID NCBI Gene 84324 |  KEGG hsa:84324
Gene Symbol SARNP
Protein Name SAP domain containing ribonucleoprotein
Synonyms CIP29|HCC1|HSPC316|THO1
Ortholog resource in our bank

  SARNP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088562 IRAL021G18 pDNR-LIB BC007099 NM_033082 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010887 W01A027D15 pENTR-TOPO IRAL021G18 BC007099 NM_033082  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081751 ARf04G07 pKA1U5 NM_033082.2  
GGAGGGGTAACAAGATGGCGACCGAGACGGTGGAGCTCCATAAGCTAAAGCTTGCCGAAC
HKR235118 ARiS087N06 pGCAP10 NM_033082.2  
GGCCTAGTGGAGTGAGGGGTAACAAGATGGCGACCGAGACGGTGGAGCTCCATAAGCTAA
HKR238551 ARiS096G07 pGCAP10 NM_033082.2  
GGAGGGGTAACAAGATGGCGACCGANNCGGTGGAGCTCCATAAGCTAAAGCTTGCCGAAC
HKR380580 RBd51H12 pGCAP10 NM_033082.2  
CGGCCGGCCGATGGTGGGGGCCTAGTGGAGTGAGGGGTAACAAGATGGCGACCGAGACGG
HKR380980 RBd52H12 pGCAP10 NM_033082.2  
GGAGGGGTAACAAGATGGCGACCGAGACGGTGGAGCTCCATAAGCTAAAGCTTGCCGAAC
HKR387307 RBd68E11 pGCAP10 NM_033082.2  
GAGTGGAGTGAGGGGTAACAAGATGGCGACCGAGACGGTGGAGCTCCATAAGCTAAAGCT
HKR405690 RBdS014D18 pGCAP10 NM_033082.2  
TGGGCCTAGTGGAGTGAGGGGTAACAAGATGGCGACCGAGACGGTGGAGCTCCATAAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl