Prev. |  KEGG KO K12880 > 

RIKEN DNA Bank Human Resource - THOC3

Gene ID NCBI Gene 84321 |  KEGG hsa:84321
Gene Symbol THOC3
Protein Name THO complex 3
Synonyms THO3|hTREX45
Ortholog resource in our bank

  THOC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001344 IRAK003F24 pCMV-SPORT6 BC006849 NM_032361
HGY067020 IRAK167J04 pBluescriptR BC068499 NM_032361 Full
HGY067362 IRAK168G18 pBluescriptR BC066325 NM_032361 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE086004 M01C015A04 pDONR221 FLJ05-B02 BC006849 NM_032361  
HGE086052 M01C015C04 pDONR221 FLJ05-B02 BC006849 NM_032361  
HGE086100 M01C015E04 pDONR221 FLJ05-B02 BC006849 NM_032361  
HGE086148 M01C015G04 pDONR221 FLJ05-B02 BC006849 NM_032361  
HGE086196 M01C015I04 pDONR221 FLJ05-B02 BC006849 NM_032361  
HGE086244 M01C015K04 pDONR221 FLJ05-B02 BC006849 NM_032361  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006002 W01A015A02 pENTR-TOPO IRAK003F24 BC006849 NM_032361  
HGE006004 W01A015A04 pENTR-TOPO IRAK003F24 BC006849 NM_032361  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR329721 RBb24F01 pGCAP1 NM_032361.2  
TGGGGCGCCAGGCACTGACTGCGCCGATGGAGGCTGCTGCACCTGTTTGTGAGTTGGAAG
HKR405627 RBdS014B03 pGCAP10 NM_032361.2  
GAGGCTGCTGCAGTGTTGTGAGTTGGAAGCTGGGGAGCTCGGCATGGCGGTCCCCGCTGC
HKR432533 RBdS081F13 pGCAP10 NM_032361.2  
GAGGACTGACTGCGCCGTGGAGGCTGCTGCAGTGTTGTGAGTTGGAAGCTGGGGAGCTCG
HKR433234 RBdS083B10 pGCAP10 NM_032361.2  
GAGCGGCGCCAGGACTGACTGCGCCGTGGAGGCTGCTGCAGTGTTGTGAGTTGGAAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl