Prev. |  KEGG KO K12189 > 

RIKEN DNA Bank Human Resource - VPS25

Gene ID NCBI Gene 84313 |  KEGG hsa:84313
Gene Symbol VPS25
Protein Name vacuolar protein sorting 25 homolog
Synonyms DERP9|EAP20|FAP20
Ortholog resources KEGG ortholog (KEGG orthology K12189) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086090 IRAL015D18 pOTB7 BC006282 NM_032353

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024418 W01A061A18 pENTR-TOPO IRAL015D18 BC006282 NM_032353  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064521 ARe61F01 pKA1U5 NM_032353.2  
AGCTTCCGGGTTTCCTGGGCTACTACGATGGCCATGAGTTTCGAGTGGCCGTGGCAGTAT
HKR279259 ARiS198C11 pGCAP10 NM_032353.2  
GGNTACTTNNATGGCGATNAGTTTNGAGTGGNCGTGCNAATATCCNTNCCCACCCTTCTT
HKR323380 RBb08H12 pKA1U5 NM_032353.2  
GGCTACTACGATGGCGATGAGTTTCGAGTGGCCGTGGCAGTATCGCTTCCCACCCTTCTT
HKR342524 RBb56F04 pGCAP1 NM_032353.2  
TGAGCTTCCGGGGTTTCCTGGGCTACTACGATGGCGATGAGTTTCGAGTGGCCGTGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl