Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT22

Gene ID (NCBI) 84304
Gene Symbol NUDT22
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 22
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087384 IRAL018H16 pOTB7 BC006129 NM_032344

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048523 ARe21F03 pKA1U5 NM_032344.1  
GGGCTGGTGAGCGCCCGCTGGAGGCTGGAGCTTCCGGGCCCTGGAAAGGGGTCCCCGCGC
HKR187275 ARi68D03 pGCAP10 NM_032344.1  
GGGAGCCTGAGGGACCCGGCGGCTGGTGAGCGCCCGCTGGAGGCTGGAGCTTCCGGGCCC
HKR070855 ARe77C07 pKA1U5 NM_032344.1  
GGGAGCCTGAGGGACCCGGCGGCTGGTGAGCGCCCTCTGGAGGCTGGAGCTTCCGGGCCC
HKR071774 ARe79H06 pKA1U5 NM_032344.1  
TGGAGCGCCCGCTGGAGGCTGGAGCTTCCGGGCCCTGGAAAGGGGTCCCCGCGCGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl