Prev. |  KEGG KO K17564 > 

RIKEN DNA Bank Human Resource - CHCHD6

Gene ID NCBI Gene 84303 |  KEGG hsa:84303
Gene Symbol CHCHD6
Protein Name coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms CHCM1|MICOS25|Mic25|PPP1R23
Ortholog resource in our bank

  CHCHD6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087343 IRAL018F23 pOTB7 BC006123 NM_032343

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056501 ARe41E05 pKA1U5 NM_032343.1  
GAGCGTTGTTGGCCCGGTTGCTCTGGAGCCGGGCTCTCGGGTCTGGTGGCTGCCGGCCCT
HKR323373 RBb08H05 pKA1U5 NM_032343.1  
GGCGTGTGCCGCGGCCGCGCGAGTCCTGGAAAGCGTTGTTGGCCCGGTTGCTCTGGAGCC
HKR394877 RBd87D05 pGCAP10 NM_032343.1  
GGCGGCCGCGCGAGTCCTGGAAAGCGTTGTTGGCCCGGTTGCTCTGGAGCCGGGTCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl