Prev. |  KEGG KO K07401 > 

RIKEN DNA Bank Human Resource - MIEN1

Gene ID NCBI Gene 84299 |  KEGG hsa:84299
Gene Symbol MIEN1
Protein Name migration and invasion enhancer 1
Synonyms C17orf37|C35|ORB3|RDX12|XTP4
Ortholog resources KEGG ortholog (KEGG orthology K07401) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088574 IRAL021H06 pDNR-LIB BC006006 NM_032339 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096439 M01C041B15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096487 M01C041D15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096535 M01C041F15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096583 M01C041H15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096631 M01C041J15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096679 M01C041L15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096727 M01C041N15 pDONR221 MGC10-C08 BC006006 NM_032339  
HGE096775 M01C041P15 pDONR221 MGC10-C08 BC006006 NM_032339  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219706 ARiS049E10 pGCAP10 NM_032339.3  
GGTACTGTGAACCCTGCGGCTTCGAGGCGACCTACCTGGAGCTGGCCAGTGCTGTGAAGG
HKR219961 ARiS049P01 pGCAP10 NM_032339.3  
GGGAGCCGGCCGCGATGAGCGGGGAGCCGGGGCAGACGTCCGTAGCGCCCCCTCCCGAGG
HKR234305 ARiS085M17 pGCAP10 NM_032339.3  
GGTCACACCCGGAAGCAGGGGCCCGAGCGGAGCCGGCCGCGATGAGCGGGGAGCCGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl