Prev. |  KEGG KO K15025 > 

RIKEN DNA Bank Human Resource - EIF1AD

Gene ID NCBI Gene 84285 |  KEGG hsa:84285
Gene Symbol EIF1AD
Protein Name eukaryotic translation initiation factor 1A domain containing
Synonyms OBELIX|haponin
Ortholog resource in our bank

  EIF1AD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085825 IRAL014J09 pOTB7 BC005131 NM_032325 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188577 ARi71H09 pGCAP10 NM_032325.2  
GAGACTCACGTCGCACTCCTCGCAGTTGGACTGGTGGGAACTGGGAACACTGGAGACCTG
HKR247211 ARiS118A11 pGCAP10 NM_032325.2  
GACGGTTTTCGGAGGGATCAGACTCAGACTCACGTCGCACTCCTCGCAGTTGGACTGGTG
HKR342525 RBb56F05 pGCAP1 NM_032325.2  
TTGGAGGGATCAGACTCAGACTCACGTCGCACTCCTCGCAGTTGGACTGGTGGGAACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl