Prev. |  KEGG KO K06928 > 

RIKEN DNA Bank Human Resource - NTPCR

Gene ID NCBI Gene 84284 |  KEGG hsa:84284
Gene Symbol NTPCR
Protein Name nucleoside-triphosphatase, cancer-related
Synonyms C1orf57|HCR-NTPase|THEP1
Ortholog resource in our bank

  NTPCR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087367 IRAL018G23 pOTB7 BC005102 NM_032324

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041380 ARe03H12 pKA1U5 NM_032324.1  
TGGGGTCCTGAGNTCGCGACCCTGGTCCGGACCTGACCTGAATTGCGACCCCAACCTGGA
HKR397660 RBd94C12 pGCAP10 NM_032324.1  
GACCCTGGTCCGGACCTGACCTGAATTGCGACCCCAACCTGGACTGCTCCCCTGACCGCA
HKR406219 RBdS015J03 pGCAP10 NM_032324.1  
GGGGCGGGTCCTGAGTCGCGACCCTGGTCCGGACCTGACCTGAATTGCGACCCCAACCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl