Prev. |  KEGG KO K10482 > 

RIKEN DNA Bank Human Resource - BTBD10

Gene ID NCBI Gene 84280 |  KEGG hsa:84280
Gene Symbol BTBD10
Protein Name BTB domain containing 10
Synonyms GMRP-1|GMRP1
Ortholog resources KEGG ortholog (KEGG orthology K10482) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX054340 IRAK135O04 pCMV-SPORT6 BC062633 NM_032320 Partial
HGY087309 IRAL018E13 pOTB7 BC005071 NM_032320 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054979 ARe37H11 pKA1U5 NM_032320.5  
GGCCTCAGTGGCTTCCTCCACAGCCACCTCCGGAGGGATCTGGCTGAGGAGGAAGTGGAG
HKR238782 ARiS096P22 pGCAP10 NM_032320.5  
GGAGAGCCAGGCTGCTGCGGCGGTGGTCTGGGCGGCCGGACCCTGCTCGGGTTATGGGTG
HKR276655 ARiS191K15 pGCAP10 NM_032320.5  
GGAGGAGCCGGCCTGCAACCTGCCGGGGCNNNNNNNNNNNCGGGCAAGNTCAAANAAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl