Prev. | 

RIKEN DNA Bank Human Resource - PRADC1

Gene ID NCBI Gene 84279 |  KEGG hsa:84279
Gene Symbol PRADC1
Protein Name protease associated domain containing 1
Synonyms C2orf7|PAP21
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087306 IRAL018E10 pOTB7 BC005069 NM_032319

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052028 ARe30B04 pKA1U5 NM_032319.1  
GAGGCTGAAGTCCTGCGAGCGACGCGCGGCGGGGCGGCGAGAGGAAACGCGGCGCCGGGC
HKR345328 RBb63F08 pGCAP1 NM_032319.1  
GGGGGCGGCGAGAGGAAACGCGGCGCCGGGCCGGGCCCTGGAGATGGTCCCCGGCGCCGC
HKR348526 RBb71F06 pGCAP1 NM_032319.1  
GGAGAGGAAACGCGGCGCCGGGCCGGGCCCTGGAGATGGTCCCCGGCGCCGCGGGCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl