Prev. |  KEGG KO K19374 > 

RIKEN DNA Bank Human Resource - DNAJC30

Gene ID NCBI Gene 84277 |  KEGG hsa:84277
Gene Symbol DNAJC30
Protein Name DnaJ heat shock protein family (Hsp40) member C30
Synonyms WBSCR18
Ortholog resource in our bank

  DNAJC30

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087213 IRAL018A13 pOTB7 BC005056 NM_032317 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057673 ARe44D01 pKA1U5 NM_032317.2  
CCTGCCGAATCAATTCAACATGGCAGCCATGCGCTGGCGATGGTGGCAGCGGCTGTTACC
HKR381299 RBd53E03 pGCAP10 NM_032317.2  
GGAATCAATTCAACATGGCAGCCATGCGCTGGCGATGGTGGCAGCGGCTGTTACCTTGGA
HKR384808 RBd62A08 pGCAP10 NM_032317.2  
TGGTGGTGAAGAATTCAACATGGCAGCCATGCGCTGGCGATGGTGGCAGCGGCTGTTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl