Prev. |  KEGG KO K15116 > 

RIKEN DNA Bank Human Resource - SLC25A33

Gene ID NCBI Gene 84275 |  KEGG hsa:84275
Gene Symbol SLC25A33
Protein Name solute carrier family 25 member 33
Synonyms BMSC-MCP|PNC1
Ortholog resource in our bank

  SLC25A33

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069887 IRAK174L23 pCMV-SPORT6 BC073135 NM_032315 Full
HGY083914 IRAL009N02 pOTB7 BC004991 NM_032315 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097629 M01C044B05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097677 M01C044D05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097725 M01C044F05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097773 M01C044H05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097821 M01C044J05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097869 M01C044L05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097917 M01C044N05 pDONR221 MGC11-G03 BC004991 NM_032315  
HGE097965 M01C044P05 pDONR221 MGC11-G03 BC004991 NM_032315  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046109 W01A115E13 pENTR-TOPO IRAL009N02 BC004991 NM_032315  
HGE046111 W01A115E15 pENTR-TOPO IRAL009N02 BC004991 NM_032315  
HGE046119 W01A115E23 pENTR-TOPO IRAL009N02 BC004991 NM_032315  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR377655 RBd44C07 pGCAP10 NM_032315.2  
GAGAGGCCGGTGAGGCGCCGGCGGCCACGCCGCGGAAGGCGCGGGCCGAGCAGAGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl