Prev. |  KEGG KO K19832 > 

RIKEN DNA Bank Human Resource - NOA1

Gene ID NCBI Gene 84273 |  KEGG hsa:84273
Gene Symbol NOA1
Protein Name nitric oxide associated 1
Synonyms C4orf14|MTG3|hAtNOS1|hNOA1|mAtNOS1
Ortholog resource in our bank

  NOA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082901 IRAL007E05 pOTB7 BC004894 NM_032313

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113629 M01C084B05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113677 M01C084D05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113725 M01C084F05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113773 M01C084H05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113821 M01C084J05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113869 M01C084L05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113917 M01C084N05 pDONR221 IMS05-G03 BC004894 ENST00000381248  
HGE113965 M01C084P05 pDONR221 IMS05-G03 BC004894 ENST00000381248  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054948 ARe37G04 pKA1U5 NM_032313.2  
GCCCTTTGGAGCTACTTCCTCATGCTGCCCGCNCGTTATACCGNTTCAGGCTGCTGAGCC
HKR327212 RBb18A12 pKA1U5 NM_032313.2  
GGCCCCTTTGGAGCTACTTCCTCATGCTGCCCGCTCGCCTACCGTTCAGGCTGCTGAGCC
HKR380107 RBd50E11 pGCAP10 NM_032313.2  
GCCCTTTGGAGCTACTTCCTCATGCTGCCCGCTCGCCTACCGTTCAGGCTGCTGAGCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl