Prev. | 

RIKEN DNA Bank Human Resource - POLDIP3

Gene ID NCBI Gene 84271 |  KEGG hsa:84271
Gene Symbol POLDIP3
Protein Name DNA polymerase delta interacting protein 3
Synonyms PDIP3|PDIP46|SKAR
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011915 IRAK029N03 pCMV-SPORT6 BC019643 NM_178136 Partial/var
HGX047650 IRAK119C02 pCMV-SPORT6 BC056912 NM_178136 Full
HGY081361 IRAL003G17 pOTB7 BC001488 NM_032311 Partial
HGY089688 IRAL024D16 pOTB7 BC007397 NM_178136

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066029 ARe65B05 pKA1U5 NM_032311.3  
GGGCTTGCTCGGCGGAGCAAGATGGCGGACATCTCCCTGGACGAACTCATCAGGAAGCGC
HKR170156 ARi25G12 pGCAP10 NM_032311.3  
GGCTTGCTCGGCGGAGCAAGATGGCGGACATCTCCCTGGACGAACTCATCAGGAAGCGCG
HKR362431 RBd06B07 pGCAP10 NM_032311.3  
GGCTTTCGGCTTGCTCGGCGGAGCAAGATGGCGGACATCTCCCTGGACGAACTCATCAGG
HKR444322 RBdS110N10 pGCAP10 NM_032311.3  
GGCGGACGCCGGAAGTAGTTCGTCGCTCCCTAGCGGCCGAAGGGGCGGGCTCGCGGGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl