Prev. |  KEGG KO K10769 > 

RIKEN DNA Bank Human Resource - ALKBH7

Gene ID NCBI Gene 84266 |  KEGG hsa:84266
Gene Symbol ALKBH7
Protein Name alkB homolog 7
Synonyms ABH7|SPATA11|UNQ6002
Ortholog resource in our bank

  ALKBH7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085322 IRAL013F02 pOTB7 BC004393 NM_032306 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054857 ARe37C09 pKA1U5 NM_032306.2  
GGCTCCGGGATTATGGCCGGGTACTGGGCTGCTGGCGCTGCGGACGCTGCCAGGGCCCAG
HKR333330 RBb33F10 pGCAP1 NM_032306.2  
GGCTCCGGGATTATGGCCGGGACTGGGCTGCTGGCGCTGCGGACGCTGCCAGGGCCCAGC
HKR336459 RBb41C11 pGCAP1 NM_032306.2  
HKR375284 RBd38D12 pGCAP10 NM_032306.2  
GGATTATGGCCGGGACTGGGCTGCTGGCGCTGCGGACGCTGCCAGGGCCCAGCTGGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl