Prev. | 

RIKEN DNA Bank Human Resource - HSDL2

Gene ID NCBI Gene 84263 |  KEGG hsa:84263
Gene Symbol HSDL2
Protein Name hydroxysteroid dehydrogenase like 2
Synonyms C9orf99|SDR13C1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030402 IRAK076A02 pBluescriptR BC036620 NM_032303
HGY036698 IRAK091M10 pBluescript BC047074 NM_032303
HGY085552 IRAL013O16 pOTB7 BC004331 NM_032303 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048974 ARe22H06 pKA1U5 NM_032303.3  
TGAGCTCTCTGCTCGCCGCCGCCGCTGTCGCCGCCNCCTCCTCTGATCTACGAAAGTCAT
HKR373708 RBd34E12 pGCAP10 NM_032303.3  
GGGAGGGACGGTCCAGCTTTAGCTCTCTGCTCGCCGCCGCCGCTGTCGCCGCCACCTCCT
HKR392081 RBd80D09 pGCAP10 NM_032303.3  
GCTCTCTGCTCGCCGCCGCCGCTGTCGCCGCCACCTCCTCTGATCTACGAAAGTCATGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl