Prev. |  KEGG KO K11877 > 

RIKEN DNA Bank Human Resource - PSMG3

Gene ID NCBI Gene 84262 |  KEGG hsa:84262
Gene Symbol PSMG3
Protein Name proteasome assembly chaperone 3
Synonyms C7orf48|PAC3
Ortholog resources KEGG ortholog (KEGG orthology K11877) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010666 IRAK026L02 pCMV-SPORT6 BC027171 NM_032302
HGY085400 IRAL013I08 pOTB7 BC004308 NM_032302 Full
HGY103201 IRAL058A01 pOTB7 BC071939 NM_032302 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243967 ARiS109P07 pGCAP10 NM_032302.3  
GACTTCCGGGCGCGGCGCCGGCTTGCTGCCACTGCAGAGCCCCGCCATGGAAGACACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl