Prev. | 

RIKEN DNA Bank Human Resource - FLYWCH1

Gene ID NCBI Gene 84256 |  KEGG hsa:84256
Gene Symbol FLYWCH1
Protein Name FLYWCH-type zinc finger 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001861 IRAK004K21 pCMV-SPORT6 BC001973 NM_032296 Partial/var
HGY013976 IRAK034P16 pBluescriptR BC028572 NM_032296 Full/var
HGY096301 IRAL040M13 pOTB7 BC018712 NM_032296 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR335653 RBb39C05 pGCAP1 NM_020912.1  
GGCTGGGAGCTGGTGCCGGGGTCGGGGTGGCGGCGGCGGCCTGGGCCGCGAGGTCGACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl