Prev. | 

RIKEN DNA Bank Human Resource - SLF1

Gene ID NCBI Gene 84250 |  KEGG hsa:84250
Gene Symbol SLF1
Protein Name SMC5-SMC6 complex localization factor 1
Synonyms ANKRD32|BRCTD1|BRCTx
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053722 IRAK134F02 pCMV-SPORT6 BC063674 NM_032290 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE027745 W01A069G01 pENTR-TOPO IRAK134F02 BC063674 NM_032290  
HGE027749 W01A069G05 pENTR-TOPO IRAK134F02 BC063674 NM_032290  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR369732 RBd24F12 pGCAP10 NM_032290.3  
GGAAGCAGTTGAGTGCTGCAGCGGCAGTCGTCGCCCCTGCCGCCGCTGCCACCGAAGGAA
HKR374001 RBd35A01 pGCAP10 NM_032290.3  
GGTTTCCCAGAGCCCGGATTCGTGAAGCAGTTGAGTGCTGCAGCGGCAGTCGTCGCCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl