Prev. | 

RIKEN DNA Bank Human Resource - FYTTD1

Gene ID NCBI Gene 84248 |  KEGG hsa:84248
Gene Symbol FYTTD1
Protein Name forty-two-three domain containing 1
Synonyms UIF
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008462 IRAK021C14 pCMV-SPORT6 BC013602 NM_032288
HGY019091 IRAK047M03 pBluescriptR BC035006 NM_032288 Full/var
HGX033126 IRAK082N14 pCMV-SPORT6 BC039734 NM_032288 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050122 ARe25F02 pKA1U5 NM_032288.6  
GGGTGCGGCGGGCTGCGTGCGCGAGTGGGAGGTGGCAGGCCTGCGACTCCGGCCTTGTCC
HKR062457 ARe56C09 pKA1U5 NM_032288.6  
GGCGACTCCGGCCTTGTCCGCGCCCGCGTCTCGCCCNTTNNNGTCTCCAGCCATGAACCG
HKR076052 ARe90C04 pKA1U5 NM_032288.6  
GGGCGGGCTGCGTGCGCGAGTGGGAGGTGGCAGGCCTGCGACTCCGGCCTTGTCCGCGCC
HKR277716 ARiS194E20 pGCAP10 NM_032288.6  
GGAGTGNGANGTGGCAGGCCTGCGACTCCGGCCTTGTCCGCGCCCGCTCTCGGCGCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl