RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MED10

Gene ID	NCBI Gene 84246 \| KEGG hsa:84246
Gene Symbol	MED10
Protein Name	mediator complex subunit 10
Synonyms	L6\|NUT2\|TRG20

Ortholog resource in our bank

  MED10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX001299	IRAK003E03	pCMV-SPORT6	BC003353	NM_032286	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR016854	ARa42C06	pKA1U5	NM_032286.2
HKR016854	GCCGGACGGAAGCAGGAAGCGGGAGCGTAGGGCCACGCCTGCGGCGCTGCTGGTTGAGGC
HKR403176	RBdS007P16	pGCAP10	NM_032286.2
HKR403176	GACGCCTGCGGCGCTGCTGGTTGAGGCTGTGTGGGTGGGGGACGGGCCGAGGCGATGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl