Prev. |  KEGG KO K17578 > 

RIKEN DNA Bank Human Resource - ZCCHC9

Gene ID NCBI Gene 84240 |  KEGG hsa:84240
Gene Symbol ZCCHC9
Protein Name zinc finger CCHC-type containing 9
Synonyms PPP1R41
Ortholog resource in our bank

  ZCCHC9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027876 IRAK069L12 pCMV-SPORT6 BC032736 NM_032280 Full/var
HGY096804 IRAL042A04 pOTB7 BC022799 NM_032280

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330882 RBb27D10 pGCAP1 NM_032280.2  
TAGGGCGGTCTTCCCCGGCTCGCCAACTCGGCTGCTCTGGGGGATTCGTGCGCGGTACCA
HKR374900 RBd37E04 pGCAP10 NM_032280.2  
GGGGGATTCGTGCGCGGTAAGAAGCTGCGCGGTAGCGCGGTGAGGTGAGGTTCTCAGCCA
HKR405975 RBdS014P15 pGCAP10 NM_032280.2  
GGGCTGCTCTGGGGGATTCGTGCGCGGTGTGTTTCCATTGTAGAAAACCTGGTCATGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl