Prev. | 

RIKEN DNA Bank Human Resource - SPATC1L

Gene ID NCBI Gene 84221 |  KEGG hsa:84221
Gene Symbol SPATC1L
Protein Name spermatogenesis and centriole associated 1 like
Synonyms C21orf56
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056370 IRAK140P10 pCMV-SPORT6 BC065570 NM_032261 Full
HGY090207 IRAL025I15 pOTB7 BC009497 NM_032261 Full
HGY103984 IRAL059P24 pOTB7 BC084577 NM_032261 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192527 ARi81F07 pGCAP10 NM_032261.4  
GCCCTTCCCATGAGGATGAGATGACCCATCTGTTGCATCCCGGCTGCTGATAAAACAAGA
HKR370579 RBd26H11 pGCAP10 NM_032261.4  
GGCCGTACGTCCCTTCCCATGAGGATGAGATGACCCATCTGTTGCATCCCGGCTGCTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl