Prev. |  KEGG KO K12597 > 

RIKEN DNA Bank Human Resource - ZCCHC7

Gene ID NCBI Gene 84186 |  KEGG hsa:84186
Gene Symbol ZCCHC7
Protein Name zinc finger CCHC-type containing 7
Synonyms AIR1|HSPC086
Ortholog resource in our bank

  ZCCHC7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031470 IRAK078L06 pCMV-SPORT6 BC036940 NM_032226 Full
HGY094646 IRAL036K06 pDNR-LIB BC034022 NM_032226 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395772 RBd89H04 pGCAP10 NM_032226.2  
GGTCCCTCTACGCGTTTTGGTTCCCGGTTGGTGCTTCCTGTTCGCAGCTGCGGCAGTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl