Prev. |  KEGG KO K16765 > 

RIKEN DNA Bank Human Resource - CEP78

Gene ID NCBI Gene 84131 |  KEGG hsa:84131
Gene Symbol CEP78
Protein Name centrosomal protein 78
Synonyms C9orf81|CRDHL|IP63
Ortholog resources KEGG ortholog (KEGG orthology K16765) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR347236 RBb68B12 pGCAP1 NM_032171.1  
TGGGGCGCCAACTGCTTGGGCCGCAGGGCGGGAGGCAGCGCGGGAGTGGGGCGTTGAGGG
HKR369702 RBd24E06 pGCAP10 NM_032171.1  
GAGGGCGGGAGGCAGCGCGGGAGTGGGGCGTTGAGGGGCCGGCCTAGCTTGGGGCTCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl