Prev. |  KEGG KO K10307 > 

RIKEN DNA Bank Human Resource - FBXO30

Gene ID NCBI Gene 84085 |  KEGG hsa:84085
Gene Symbol FBXO30
Protein Name F-box protein 30
Synonyms Fbx30
Ortholog resource in our bank

  FBXO30

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184025 ARi60B01 pGCAP10 NM_032145.4 done
GAGGCCGGGAGAAGAGAAAAGGCGGCGGCCCGGCTGGGGAAGAGGGGCGGAGGAGGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl