Prev. | 

RIKEN DNA Bank Human Resource - ZRANB3

Gene ID NCBI Gene 84083 |  KEGG hsa:84083
Gene Symbol ZRANB3
Protein Name zinc finger RANBP2-type containing 3
Synonyms 4933425L19Rik|AH2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055688 IRAK139D16 pCMV-SPORT6 BC064616 NM_032143 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368150 RBd20G06 pGCAP10 NM_032143.2  
GCTTTTCCCACGAGTTGGAGCCTGAGGATCATCATGCCTAGGGTTCATAACATAAAAAAG
HKR372850 RBd32C02 pGCAP10 NM_032143.2  
GCTTTTCCCACGAGTTGGAGCCTGAGGTGCGGAGTTTCGTGAGTTTTTACTGACTCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl