Prev. |  KEGG KO K13206 > 

RIKEN DNA Bank Human Resource - NSRP1

Gene ID NCBI Gene 84081 |  KEGG hsa:84081
Gene Symbol NSRP1
Protein Name nuclear speckle splicing regulatory protein 1
Synonyms CCDC55|HSPC095|NEDSSBA|NSrp70
Ortholog resource in our bank

  NSRP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04932 SEREX clone NGO-Pr-28 (ID632, 633) #1 SEREX clone NGO-Pr-28 (ID632, 633) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033669 IRAK084C21 pCMV-SPORT6 BC040118 NM_032141 Full
HGX042817 IRAK107A17 pCMV-SPORT6 BC046116 NM_001033563 Full
HGY100749 IRAL051O13 pDNR-LIB BC062425 NM_001033563 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122522 ARh06F02 pGCAP1 NM_032141.2  
GGGAGGCGTCGGCCACGTTCAGCGGACACGGGAGCAAGATGGCGATTCCGGGCA
HKR402810 RBdS007A10 pGCAP10 NM_032141.2  
GGGCCACGTTCAGCGGACACGGGAGCAAGATGGCGATTCCGGGCAGGCAGTATGGGCTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl