Prev. |  KEGG KO K20189 > 

RIKEN DNA Bank Human Resource - DTNBP1

Gene ID NCBI Gene 84062 |  KEGG hsa:84062
Gene Symbol DTNBP1
Protein Name dystrobrevin binding protein 1
Synonyms BLOC1S8|DBND|HPS7|My031|SDY
Ortholog resource in our bank

  DTNBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091460 IRAL028K20 pOTB7 BC011912 NM_183041 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100405 M01C051A05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100453 M01C051C05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100501 M01C051E05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100549 M01C051G05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100597 M01C051I05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100645 M01C051K05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100693 M01C051M05 pDONR221 MGC15-A03 BC011912 NM_032122  
HGE100741 M01C051O05 pDONR221 MGC15-A03 BC011912 NM_032122  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040534 W01A101F14 pENTR-TOPO flj0001a09 AK054593 NM_183041 done
HGE040540 W01A101F20 pENTR-TOPO flj0001a09 AK054593 NM_183041  
HGE040542 W01A101F22 pENTR-TOPO flj0001a09 AK054593 NM_183041  
HGE040544 W01A101F24 pENTR-TOPO flj0001a09 AK054593 NM_183041  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR333776 RBb34H08 pGCAP1 NM_032122.3  
GGCGCGGGGCGGGAACGCGGAAGGGGCTGGGGTTGCGGCGCGGCGGCGAGGACCAGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl